The vector pegfpc1 clontech contains the immediate early promoter of human cmv and sv40 polyadenylation signals to drive expression of the egfp. Digital collection of empty plasmid backbones from publications and commercially available sources. Bcl i sites are methylated in the dna provided by clontech. Peg3ypw1 promotes p53mediated apoptosis by inducing bax. Synthetic construct camuialpha gene, complete cds 2,994 bp linear othergenetic ay928551. The antisak and apai for the digestion of pcdhasak s1 and ligated the cdna antibody at 1. The egfpbax was constructed by fusing the orf of human bax into the carboxyl terminus of egfp in. An enhanced green fluorscent protein allows sensitive detection. Im trying to set up the transfection technique in my new lab. Tbusa, formerly known as clontech laboratories, inc. Welcome to vector database vector database is a digital collection of vector backbones assembled from publications and commercially available sources. Provide pegfp c1 vectorplasmid map, full length sequence, antibiotic resistance, size and other information.
Monocarboxylate transporter mct1 promotes tumor metastasis. Keywords pegfpc1 source synthetic dna construct organism synthetic dna construct reference 1 bases 1 to 4731 authors clontech title direct submission comment features location. This is a free resource for the scientific community that is compiled by addgene. We also offer dsred2, a red fluorescentprotein that derives from a coral. Description pegfp c1 encodes redshiftedvariant wildtypegfp whichhas been optimized brighterfluorescence higherexpression mammaliancells. Am using clontech s pegfp c1 vector along with lipofectamine2000 on 293t cells. They may not be used for any other purpose, including, but not limited to, use in drugs, in vitro diagnostic purposes, therapeutics, or in humans. Since the pegfp vector carries the egfp gene, any expressed fusion proteins from the pegfp plasmid will contain both the target protein and the egfp protein. The eukaryotic expression vector pegfp c1 bmp2 was originally generated and transfected into cos7 cells to explore the function of bmp in bone and cartilage development.
Protocol 0331 electro cell manipulator keywords ecm600630 electroporation protocol, cell, huh7, human hepatoma, transfectant, pegfpc1, clontech, electro cell manipulator. Westernblottingsdspageandwesternblotanalysiswas done as described 31. Construction of a eukaryotic expression vector pegfpc1bmp2. Gfprip111218was generated by digesting pegfp c1 rip11 with bamhi and religating the backbone. The aim of this study was to construct the eukaryotic expression vector pegfp n1hper2 and assess its expression in the human osteosarcoma cell line mg63. Construction of recombinant pegfpn1hper2 plasmid and its. Clontech takara download free trial get snapgene viewer. The mammalian pegfp c1 vector carries the green fluorescent protein gene under the control of the cytomegalovirus cmv promoter. The xba i site is methylated in the dna provided by clontech. If you wish to digest the vector with these enzymes. Pdf a novel terminator primer and enhancer reagents for. Corvera lab tagrfpteea1 page 1 wednesday, january 30, 20 9. Pr1y691 living colors user manual red fluorescent protein. Fusions to the n terminus of egfp retain the fluorescent properties of the native protein allowing the localization of.
Mhgx contains a factor xa cleavage site between egfp and the protein of interest. Without the addition of a functional promoter, this vector will not express. To construct nterminal tagging plasmid, pcr was performed with a 5. Is it true what with the above reagentsmaterials, i could only get transiently transfectant, but not a.
The pacgfpd4 plasmid was prepared by switching egfp fragment of pegfpd427 with. The resulting pcr product was cloned into the same sites in the vector pegfpc1 clontech. Hindiiibamhi fragment from pegfp c1 rab11fip2 into the hindiiibamhi site of pegfp c2 clontech. A novel terminator primer and enhancer reagents for direct expression of pcramplified genes in mammalian cells. Mammalian expression vector with cmv promoter, egfp tag. Department of anatomical sciences, faculty of medicine. The bcl2 expressing plasmid and antisense peg3ypw1 vector were described elsewhere 29, 30. The fusion vector can also be used as a cotransfection marker since the unmodified vector will express fluorescent protein. Is it true what with the above reagentsmaterials, i could only get transiently transfectant, but not a stable line. The resulting pcr product was cloned into the same sites in the vector pegfp c1 clontech.
For license information, please contact a licensing representative by phone at 650. Forprofit entities wishing to use this product are required to obtain a license from clontech. Supplemental data autophagy inhibition compromises. Cholesterol asymmetry at the tip of filopodia during cell.
The effects of the overexpressed bmp2 on the migration of cos7 cells and the underlying molecular mechanism were investigated. Clontech makes gfp and gfp variants available for research purposes through its line of living. As an irrelevant control plasmid, pflagmacgap 28 was transfected, or where indicated, pegfpc1 clontech, encoding enhanced green fluorescence protein egfp. Human cytomegalovirus cmv immediate early promoter. The c2 domains of the class i rab11 family of interacting. The gfp reporters whose expression is controlled by either mir32 or mir23 were constructed by annealed primers cloned into the bamhihindiii sites of pegfp c1 mir32 target sens, agcttgatgcagctttgcaatatgctg, mir32 target antisens. Vector for fusing egfp to the nterminus of a partner protein. Gfprcp200649was constructed by ligating the salibamhi fragment from pegfp c3 rcp into the salibamhi site of pegfp c1.
I sites are methylated in the dna provided by bd biosciences clontech. Producing a mammalian gfp expression vector containing. To study the effects of bmp2 on cell migration and to explore further the molecular mechanism, a eukaryotic expression vector pegfpc1 bmp2 plasmid was constructed and transfected into cos7 cells by liposomes. I need to clone the cdna of a type ii transmembrane protein from tnf super family and i need to make sure that the produced protein will be expressed properly on the cell surface hek293 cells. If you wish to digest the vector with these enzymes, you will need to transform the vector into a dam host and make fresh dna. Is pegfpc1 a good vector to express a type ii transmembrane. Chinese cuisine wei chuan pdf download free software.
Farnesyltransferase inhibitors induce cytochrome c release. Receive the latest news, hot plasmids, discounts and more. Gfp in either pegfp c1 or pegfp n3 clontech was replaced by 2xflagdykddddkorwith2xhaypydvpdyatocreatevectors2flag c1,2flagn3,and2ha c1. Cloning vector pegfp c1, complete sequence, enhanced green fluorescent protein egfp and neomycin phosphotransferase genes, complete cds. For other reading frames, use pegfp n1 or pegfp n2. Axel ullrichs lab contains the insert pkm2 and is published in cancer res. This project is supported bytokuewhich specializes in manufacturing ultrapure antibiotics for a broad spectrum of biotechnology applications as well as for the pharmaceutical industry. Mammalian expression vector, adds cterminal gfp tag. Restriction map and multiple cloning site mcs of pegfpc1. Construction of a eukaryotic expression vector for pegfpfst.
Pegfp c1 vector information pt30285 vector information. The protein is incorporated into growing actin filaments and allows for visualization of actincontaining subcellular structures in living and. Stable transfection of pegfpn1mog plasmid to utilize in. Vector for fusing egfp to the cterminus of a partner protein. Expression vector of mouse rab27a constitutive negative mutant, t23n, fused with egfp at nterminus.
Learn about the latest plasmid technologies and research tools. Gfpwasexpressed from pegfp c1 and 2gfp from the same backbone to which another gfp was added with a bamhibamhi restriction. Promoters should be cloned into the pegfp 1 mcs upstream from the egfp coding sequences. Two tags were included to increase the efficiency of the immunoprecipitation. For other reading frames, use pegfp n2 or pegfp n3. Michael mancinis lab contains the insert androgen receptor and is published in hum mol genet. All dna constructs were confirmed by dna sequencing.
Gfprcp1199was generated by ligating the 600 bp sali fragment from pegfp c3 rcp into the sali site of pegfp c3. The coding sequence of the egfp gene contains more. All restriction sites shown dnaprovided bdbiosciences clontech. The resulting fragments were cloned into the bamhi and noti sites of pacgfphygn1 clontech. Xba i and bcl i sites are methylated in the dna provided by clontech laboratories, inc.
The resulting pegfp c1 casp3 plasmid and the pegfp c1 vector were transfected into mcf7 cells using lipofectamine gibco. N and c are, as you thought the nterminal and cterminal tags, often it is a bit counterintuitive for these though, for example in the pegfp c1 plasmid, if you clone into this, the gfp will be nterminal to the insert i. To study the effects of bmp2 on cell migration and to explore further the molecular mechanism, a eukaryotic expression vector pegfp c1 bmp2 plasmid was constructed and transfected into cos7 cells by liposomes. How to obtain a stable transfectant aug022005 hi, all. Provide pegfpc1 vectorplasmid map, full length sequence, antibiotic resistance, size and other information. Construction of a eukaryotic expression vector pegfpc1. In all cloning experiments, the vector was cut by the appropriate restriction enzyme and run on a 1% agarose gel. May 28, 2017 pegfp c1 vector information pt30285 vector information. Acgfp1 has 94% homology to egfp at the amino acid level acgfp1 and egfp have similar excitation and emission maxima. This vector allows expression of a protein of interest as a cterminal fusion to acgfp1. Have questions about your order, deposit, or a plasmid.
This is a free resource for the scientific community that is compiled by addgene this page is informational only this vector is not available from addgene please contact the manufacturer for further details. To generate pegfpsak, a murine sak cdna construct, we used ecori hydrogen peroxide for 30 min at ambient temperature. A repository of over 200,000 plasmids including protein structure initiative protein expression plasmids and vectors, over 75,000 human plasmids, and whole genome collections from many organisms. Jan2720 im still new in my research lab, and ive realized that a lot of the plasmids that i use are in n1 or c1. Total mrna was extracted from human osteosarcoma mg63 cells, the human period 2 hper2 gene was. Supporting information drsctripfunctional genomics resources.
1565 41 1444 1539 45 506 214 106 216 1505 1520 688 1630 676 499 1413 1029 730 359 1080 1329 1330 1576 313 974 139 1240 961 1064 589 411 1253 444 925 1240 942 1035 878 1132